Animal of the Week -- December 31, 2007

Happy gnu deer!

It seems only right that I should ring in 2008 with at least a passing reference to the new species of giant rat and ungiant opossum discovered in the Foja mountains of Indonesia's Western Papua province a couple of weeks back. But there was a slew of marsupial AOTW in may, and you'll already know all about that giant rat, Mallomys -- unafraid of humans, five times the size of a city rat, closely related to several other species of giant rat found on the same island -- so why bother with Mallomys when there are other gianter rats, twice the size, that save human lives.

This week's animal is the 3 kg Cricetomys gambianus (Gambian pouch rat). Distributed across sub-Saharan Africa, from Nigeria to Zululand, these animals take their name from the Gambia where some of them live, the cheek pouches that allow them to transport fruit, seeds, and other foods, and from their rattiness. Although they are not actually that closely related to Norwegian or black rats with which you may be more familiar if you haven't spent substantial time in Africa.

You can distinguish Gambian pouch rats from their close relatives, Emin's pouch rats, not by their ability to make a bed or their sobriety on TV, but by their coarser brown fur and their single-note squeal which contrast with the latter's silky grey fur and multi-pitch squeaking (presumably the link to Emin).

Able to have nine litters a year, these animals occasionally reach pest proportions in some towns and agricultural land where they can destroy crops. The rats have no natural predators, because, while the occasional one might be eaten by opportunist snakes, cats, dogs, eagles, and mongooses, these giant rats, when threatened, band together and rear up on their hind legs to see off aggressors.

If you are feeling uneasy about the prospect of bands of bipedal squealing giant rats, don't worry. Humans have the upper hand, both species of pouched rat are highly regarded as food in much of their range. More pleasingly though, these animals are increasingly kept as pets. Humans have also begun to exploit the rats' excellent sense of smell, in Mozambique they have been trained to sniff out undetonated landmines, and even more implausibly they are now being trained to diagnose tuberculosis by smelling saliva samples. No, really, they can get through hundreds of samples in much less time than humans using conventional diagnostics and they are much cheaper, more portable, and less likely to go wrong in tropical Africa than other tests.

What wonderful rats!

Animal of the Week -- December 17/24, 2007

You know, sometimes, when the pressure is on, I get performance anxiety and and I just can't deliver? And I am also sorry that I missed Animal of the Week last week.

I've done—in the sense of having covered them in Animal of the Week—turkeys, donkeys, and, of course, in last year's special, 364 animals (http://animal-of-the-week.blogspot.com/2006/12/animal-of-week-december-1825-2006-deep.html), so what is there left for me to do at this time of year? What festive animals are left—the chuckwallah, the mangabey, the roadrunner? Well no, this week I bring you, dear reader, a gift of the animals that bore the Magi with their presents into The Gospel of Matthew, Camelus dromedarius (dromedary, one humped camel)

If you were a wise man from the east looking for a fictional king of kings in the middle east 2007 years ago, guided by naught but a star, you could do much worse than take a dromedary as your steed. Able to travel huge distances in arid deserts, losing 30% of their body water, while carrying a huge load of gold, frankinsense, and myrrh, one-humped camels were the ultimate in desert transport; due to the lack of water, ships are pretty useless.

With their double row of eyelashes, ability to drink 100 L of water in 10 minutes, and a hump containing 35 kg of fat meaning they can go two weeks without food, dromedaries are supremely well adapted to the desert. The camel hoof is less well adapted to the desert as it doesn't half itch when the sand gets in. But dromedaries are pretty much the best animal to have in the desert and so rapidly did the craze for camels as desert transport catch on, that soon after the first bright spark had the idea to domesticate them, all the dromedaries were snapped up, and there is now not a single wild one left across their original range in West Asia and the Arabian Penninsular. There are, however, half a million feral camels in the Australian outback. Having lost their crown as Australia's best adapted desert mammal, the red kangaroos haven't half got the hump. Australia's honey-pot ants, in which a certain caste has grossly distended abdomens filled with a honey like sugar, are thought to feel totally unthreatened by the camels' presence in their status as Australia's foremost dessert animal.

Ho ho ho.

You've seen this before I am sure, but here's a song about the dromedaries' South American cousins, llamas http://www.albinoblacksheep.com/flash/llama

Animal of the Week -- December 3, 2007

Apologies if last week you didn't receive an image with AOTW, so distracted was I by the handfuls of straws and the scrapings from the bottom of the barrel all around me that I neglected to send an image. Mind you, as it was an extinct animal, the images weren't that great, but you can see an impression of the beast here: http://animal-of-the-week.blogspot.com/2007/11/animal-of-week-november-26-2007.html.

This week I am somewhat spoiled for pictures. For the animal is a vision of grace and beauty, very much alive, and seemingly up for posing for a good shot or two. This week's animal is Python molurus bivittatus (Burmese python), one of the world's longest, heaviest, and apparently friendliest snakes. In the Cambodian village of Sit Tbow, Chamreun, a 4.8 m long snake has adopted Sambeth Uon as her companion. Having first crawled into Sambeth's crib when he was a boy and she a 50 cm snakelet, Chamreun has returned to Sambeth after each of several attempts by his parents to relocate her from their home to the wild. Sambeth now says that he loves the python like a sister, and the family's neighbours have adopted the snake as a village mascot believing that she brings luck, she also brings a bloody great feeding bill, munching her way through forty chickens a week.

Growing up to 8 m in length, Brumese pythons are typically wary of people and would rarely seek out human company. Even when kept as pets they aren't renowned as the most affectionate snakes. In 1992, a Florida teenager was killed by his pet Burmese python, the 24 kg snake constricting the 60 kg boy. Suffocating him with a series of deadly coils wrapped around his neck and chest. The snake did not attempt to eat the Florida teenager, although there are records of larger Burmese pythons eating adult humans. Burmese pythons are able to eat food up to one quarter their length and the same weight as them, so Chamreun could make short work of Sambeth, but the boy doesn't seem at all worried about this prospect, saying "She is my best friend and protects me from danger. All my other friends are jealous of her." I am not sure jealousy is quite right, perhaps you want to try terrified, Sambeth.

Popular as pets, escaped populations of these leviathan snakes have established themselves in Australia and the USA. An Australian farmer was surprised when, after the disappearance of several sheep, he went out one morning to find a Burmese python with a sheep sized bulge in its belly trapped under his newly erected electric fence. And an Everglades ranger was a little more than surprised when he came across the grizzly scene in one of this week's photographs a couple of years back, a Burmese python ruptured during the act of swallowing an Alligator, both reptiles dead in a gruesome tableau.

Animal of the Week -- November 26, 2007

So sorry about my absence last week,

I shouldn't let work get in the way of what's really important now, should I? So here it is to make up for my absence, a monster animal of the week, for this week's animal is Jaekelopterus rhenaniae.

You will no doubt have heard about the 45 cm claw of a sea scorpion discovered in Germany recently, its owner, at 2.5 m long and armoured with a broad carapace and jointed exoskelton would have dwarfed a human, had it ever met one. Fortunately for us, they've been extinct for more than 400 million years. Indeed, the whole group of sea scorpions are not something you need worry about bumping into on a day out in Bournemouth -- as you might a string jellyfish (Animal of the Week, November 12) or a bunch of chavs -- because they are all extinct, and although most of them did have a long spike at the end of their tails, this probably didn't have a sting in it. Sea scorpions, eurypterids, were possibly ancestors to all scorpions, spiders, and mites alive today.

Along with the 2.5 m millipede Arthropleura, Jaekelopterus rhenaniae is the largest arthropod (the group comprising crabs, insects, tardigrades, and spiders) ever to have lived. By comparison, the largest living arthropod is the Japanese king crab, which can have a leg-span of 3.5 m, but its body reaches only about 40 cm across and it weighs about 20 kg, its two largest relatives would have weighed a darn site more, even before they were fossilised, although the king crab is probably tastier, especially since they were fossilised. Insects and their ilk absorb oxygen through largely passive methods, Arthropleura and Jaekelopterus lived in times when the atmosphere and seas were far richer in oxygen than today, thus allowing the lazy blighters to grow to greater sizes than any modern creepy crawlies.

Anyway, there you go, the sea scorpion, extinct, huge.

Animal of the Week -- November 12, 2007

Hello Hello Hello one and all...

This week's animal of the week is Apolemia uvaria (pearl chain or string jellyfish). Although called "jellyfish", this ribbon of wobbly stuff is actually a colony of organisms, like a Portuguese man o' war. Each individual has a prescribed function -- some are occupied by food acquisition, some reproduction, and others locomotion. The component animals are each only a centimetre long, but the whole colony of a pearl chain jellyfish can be up to 30 metres long!

Typically, these great ribbons trail behind their gas-filled sails in deep open seas and oceans, but recently they have been spotted in British coastal waters. While being quite impressive to look at, they are cause for concern; like the Portuguese man o' war they have vicious stings. Several years ago a bloom of these animals caused serious damage to the Norwegian salmon-farming industry as many fish were killed by their sting. Unlikely to be fatal to people, caution is advised as the sting is likened to that of a wasp.

Selma Pollock, 34, and David Jones, 35, were scuba diving off the coast of Cornwall last week. They were having a marvellous time in the clear autumn waters when David spotted something strange, he went to investigate. Seeing the pretty string jellyfish but not knowing what it was he took a piece of driftwood in hand and used it to investigate the strange creature. Selma wondered what David was up to and went to investigate. Her curiosity as to what David was doing waving his wood around turned to horror when she got a little too close, she certainly was not impressed with the pearl-chain necklace David had given her.

Bye then!

Animal of the Week -- November 5, 2007

Oooo.... ahhhh!

Gosh! Wow!

Yay!

Ahhhhhhh!

As the cordite-scented mists clear from Britain's green pastures and gardens tomorrow morning, anyone with an ounce of sense will be out sifting through the remains of the bonfires. Being careful not to burn yourself on still glowing embers, if you are lucky you may just find the odd baked remnant of this week's animal Erinaceus europaeus (western european hedgehog), which is delicious served with bubble and squeak and a little piccalilli. Yumski!

Large piles of kindling and tinder are oh so tempting to hedgehogs looking for somewhere to hibernate. So they are perfect traps with which to bag a few of these spiny delicacies. Alternatively, if you want not to contribute to the annual slaughter don't build your bonfire until late today or check any that you have built already carefully, rebuilding on a new site to ensure that there are no hedgehogs therein. Move any hedgehogs you find to a secluded place of safety and refuge away from any bonfires... the central reservations of motorways for example.

Q: Why did the hedgehog cross the road?

Answers on a postcard to animaloftheweek@yahoo.co.uk

Bye my lovelies!

Animal of the Week -- October 29, 2007

Hello,

Bets have no doubt been placed on what this week's animal of the week will be. I hear Ladbrookes were offering 3 to 1 on the least weasel, and William Hill had stopped taking bets on the Yeti (a bear with mange? No way Jose! http://www.ogpaper.com/news/news-01178.html) Sunday at 6 pm.
Those among you thinking that I might reprise the Androscoggin beast (http://animal-of-the-week.blogspot.com/2006/08/animal-of-week-august-21-2006.html) or vampire bat (http://animal-of-the-week.blogspot.com/2005/10/animal-of-week-october-31-2005.html) in honour of Hallowe'en, are sorely mistaken: I simply don't have enough weeks to repeat animals. No, this week's animal is more frightful and terrifying than the unlikely offspring of the all four. For this week's animal is the undying, undead, perhaps immortal Arctica islandica (ocean quahog clam, Icelandic cyprine).

Over 400 years ago, as Shakespeare was writing some of his finest comedies and The Merry Wives of Windsor, as British settlers were staking a claim to parts of North America, as the Dutch were routing the Spanish at the Battle of Gibraltar, as the Ming Dynasty was ruling China, as Menzies Campbell was contemplating joining the Liberal Democrats, and as Joan Rivers was having her first course of botox, a quahog was taking up residence on the north Atlantic seabed. Little did it know that having weathered four centuries of sucking the life out of sea water, this clam would be dredged up by scientists from Bangor University (oh, the shame, Welsh!) and slice apart in the name of science. Its ignominious end at the hands of marine biologists has secured a place for this mollusc in the record books as the oldest know animal.

For comparison, the oldest know human was Jeanne Calment, a French chain smoker who outlived her grandchildren and eventually pop her clogs at the ripe old age of 122 and the oldest know tortoise was Adwaita, Clive of India's tortoise, which died last year after an innings thought to be about 250 years. This quahog, the age of which was determined by counting growth increments in its shell as one might count the rings in a cut tree, knocks both into a cocked hat and surpasses other records for its own species by about 30 years. Doesn't really have much on the various pine tree species that live upwards of 10 000 years, but who gives a fig about plants?

Well done that clam!

Animal of the Week -- October 22, 2007

Distressing news Ani-freaks, the devil facial tumour virus that is wiping out Tasmanian devils has spread to a previously uninfected population that had been viewed as a safeguard for the species' future. Now conservationists think that finding uninfected wild devils may be impossible from the middle of next year. Once infected the tumours impede feeding and lead to starvation within 6 months. Eeek! Could this be it for the inspiration for a much loved cartoon character? Could the Tasmanian devil soon be heading the same way as this week's animal of the week, its larger, more ferocious, and more extinct cousin Thylacinus cynocephalus (Tasmanian tiger, Tasmanian wolf, thylacine)?

Neither tigers nor wolves, thylacines were the largest marsupial predators to survive into modern times and were a little smaller than a wolf. Once widespread across New Guinea, mainland Australia, and Tasmania, they became extinct on the mainland about 2000 years ago, and by the time Europeans arrived, their range was, like that of the devil, restricted to Tasmania. Viewed as a threat to livestock, a bounty of £1 for adults and 10 shillings for pups, was paid for their capture; at about the same time in Tasmania the bounty for aborigines was £5 for adults £2 for children.

By 1900, thylacines were hard to find (the aborigines were impossible to find by this time) and a conservation programme was set up in 1901 to safeguard the species for addition to collections and zoos. However, the combination of persecution, habitat loss, and disease had sent the species into terminal decline. Benjamin, captured in 1933, was the last known living thylacine, and he resided in Hobart zoo until his death in 1936. There have been many reported sighting of thylacines from New Guinea to Tasmania since 1936, but none has been verified, although many people believe they still cling on in remote regions, in 1986 they were declared officially extinct and any attempt to study their presence in the wild is branded as cryptozoology.

Although named Benjamin, the gender of the last thylacine was unknown. While we're on the subject of gender, thylacines were one of only two types of marsupial in which the male had a pouch. The pouch was unlike the females' pouches, but like those of the male South American water opossums, the male thylacine's pouch was used to support their pendulous scrotum!

With an enormous gape and an incredibly strong jaw (pound for pound they probably had the greatest bite pressure of any mammalian carnivore), thylacines were fearsome beasts. Although there is no evidence to suggest that they were a threat to humans, as this week's photo shows they could easily fit the head of a prat with a dodgy moustache into their mouths (the moustache is also extinct, or at least hiding very well in a protobeard).

OK, bye then!

Peter Hayward
Head Keeper
Animal of the Week

Animal of the Week -- October 15, 2007

Hello!

I tell you what, I am sorely tempted to revisit an old animal of the week http://animal-of-the-week.blogspot.com/2005/03/animal-of-week-march-21-2005.html. Great quantities of harlequin ladybirds hang in the air outside and off the external walls of the flat looking for a way in. A cluster of the blighters having formed around the curtain-pole fitting in my landlady's room, her application of brief squirt of insecticide spray quickly had a shower of these pernicious beetles clattering to the floor. Don't feel too bad about this, they are a non-native species (unless you live in the far east) and, well, even though it won't make a difference to their inexorable march across Europe or North America, it's one in the eye for the native ladybirds. Obviously, if you choose to annihilate the plagueybirds, be careful that you are killing the harlequins and not native species of ladybirds, which need all the help we can give them.

But why should I give such a creature two weeks? So, this week's animal is Antidorcas marsupialis (springbok). Their name is a conflation of the Afrikaans words for jump and antelope, and springboks are graceful gazelle like creatures from south and southwest Africa. With a dramatic black stripe along either flank and sweeping lyre-shaped horns springboks are instantly recognisable. And if in any doubt about whether you are looking at a springbok or not, scare it. When agitated, springboks jump stiff leggedly into the air with their heads pointed to the ground, taking off again as soon as they land, they also raise a flap of skin along their back that splays long white hairs coated in a floral scent. This activity known as pronking might be a signal to predators that they have been spotted and that the springbok can outrun them, or it might be an indication that the pronking springbok is in excellent health and that the predator would be better off going for a non-pronker.

And what are the predators of springboks that induce such pronking in the wild? Yeah, that's right, lions... If only I could make this topical in some way...

If I had a pet springbok, ok, I would probably have to have a licence, but most importantly I would call him Rodney, I'd take him for a walk down the road to Peckham, I'd stand him outside one of those butchers that sell every kind of meat imaginable, most with the heads still on with their glassy clouded eyes staring accusingly at the pedestrians, until he became nervy and started his display. I'd then stand there and point at him loudly exclaiming "Oh Rodney, you pronker". I'd then run away giggling, a disdainful and slightly hurt springbok trailing behind me on a string.

Thanks chaps,

Peter Hayward
Head Keeper
Animal of the Week

ps, having struggled this far through AOTW, you will be shocked to learn that I am both an editor and a writer. Now that my MSc is over and before I have to return to selling what god gave me for £20 a pop above a Soho hairdressers, I am looking for freelance/temporary/permanent work. Do you know anyone who needs any editing and/or writing done? If so, please let me know.

Animal of the Week -- October 8, 2007

There's somebody at the door, there's somebody at the door!

Those of you who observe the days of the Saints may have marked October 4, the feast day of renowned hermit and animal lover Francis of Assisi, by having your pet blessed at your local catholic congregation on this Sunday just gone. And what pet did you have blessed? Maybe a cat or a dog, or a cat, or a dog, or another dog? Poor priests, the highlight of their day would be some batty ageing zealot bringing in a fluffy toilet-seat cover. Well, here's some wonderful news for priests in the UK, next year's animals may include any one, or perhaps all, of 33 species for which a special licence is no-longer required to keep them as pets. And what a list of species--do you fancy owning a kodkod (a miniature spotted cat), a cacomistle like Paris Hilton's Baby Luv, perhaps a raccoon called Bert, or maybe this week's animal of the week Dromaius novaehollandiae (emu).

An emu is approximately the length of a man's arm from rear to beak, its blue-purple shiny plumage and bright red neck make the bird instantly recognisable. Emu can afford to be showy and conspicuous, because its terrible temper ensures that it has no natural enemies but for a fat green witch, but when threatened the emu seeks shelter in a pink windmill with a bunch of kids and a strange old man who looks for all the world like the love child of Willy Wonker and Wurzel Gummage. JUST KIDDING, THAT WAS A KIDS TV PROGRAMME FROM MY YOUTH YOU SILLIES! (Although I didn't watch it because it was on ITV.)

At 2 m tall, emus are the largest birds of Australia and the second largest extant birds. Like their cousins, ostriches, cassowaries, rheas, and kiwis they are flightless. Rod Hull's emu, much like the man himself[thanks A Watts], was also flightless, but real emus are brown-grey with a blue-grey neck, and very rarely have a man hanging out of their bottoms...mind you, some parts of Australia are very remote and a man could get lonely. Able to run at speeds of up to 30 miles per hour for sustained periods of time, emus leg muscles make up a similar portion of their body weight as do the wing muscles of birds that have not lost the power of flight, and like turkey breasts, the legs of emus are a tasty low calorie treat. Besides their meat, emus are farmed in Australia, North America, Argentina, and Chile for their leather, feathers, eggs, and oil. Yes, their oil...used mostly in cosmetics and dietary supplements, emu oil is also thought to have anti-inflammatory properties.

So, there you go UK folks, no longer do you need to worry about getting a licence for your emu, hiding it when the inspectors come around, or insisting you only use it to watch DVDs. Get one, rejoice, and next feast day of St Francis, take it to your priest and brighten up his day with a little variety. Or simply feast on your emu if you aren't that bothered about saints.

Animal of the Week -- October 1, 2007

Hello one, hello all,

There are probably more than just a few fans of Sandi Toksvig (and no that is not code) among the readership of AOTW, so I would like to apologise up front for the recycling of a joke made by the diminutive Dane on the News Quiz last week. The joke will naturally stick out like a sore thumb among the remainder of my humourless rambling.

This week's animal is Crocodilus porosus (saltwater or estuarine crocodile), the largest reptiles alive in the world today. All around the eastern Indian Ocean and into parts of the western Pacific, these humongous reptiles inhabit the coastal waters and freshwater swamps, rivers, lakes, and billabongs. Pretty much anything is on the menu for salties, from dragonflies and tadpoles for the chicks, to people, dingoes, leopards, kangaroos, and water buffalo for adult males. The largest male ever recorded was 8.6 m (28.3 ft) long, for such a beast Toksvig would have been a mere morsel.

Saltwater crocodiles are thought to be the only animals that think of people as regular prey and they cause about 300 deaths worldwide annually. Although the big question is who would win in a fight between a shark and a crocodile. The largest great white and the largest bull saltie are well matched in size, although sadly for them as love a good "who would win discussion", they'd never meet, crocodiles having a tropical range (and the largest ones mostly fresh water) and great whites being animals of temperate regions. Should the crocodiles meet the slightly more diminutive tiger sharks, the two would probably ignore each other, both preferring easier prey, the shark might take smaller crocs, and the croc maybe smaller sharks (see pic).

Of the 23 species of crocodile or alligator in the world today, the saltie is the least endangered, although in parts of south Asia and the Pacific these magnificent beasts have become locally extinct due to habitat loss and conflict with people Fortunately the vast empty expanses of northern Australia and New Guinea and these animals remarkable ability to disperse through deep ocean water means that the species should be safe.

Where they do come into conflict with human beings in Australia, policy has been to transport them from residential areas and pleasure beaches to areas not frequented by people. However, researchers tracking relocated animals were surprised to discover that some had navigated up to 150 miles to make it back to the area from where they were removed. Turns out that saltwater crocodiles, particularly the males, are highly territorial. They travel great distances through rivers and coastal waters to find patches not already inhabited to which they can stake their claim and once they find them, they stick to them.

Will this discovery see Yorkshire folk forsaking their homing pigeons in favour of these distant relatives of birds for crocodile races? Probably not until global warming really kicks in. Although the ability of these cold-blooded, dangerous, ancient reptiles to traverse great distances to navigate home after long periods of time does at least explain Margaret Thatcher's recent reappearance at Number 10 (thanks Toksvig).

Bye!

Animal of the Week -- September 24, 2007

Good Monday Anifreaks!

Honourable mention to Paul Genders (age 27 and five-sixths) who was the only person to tell me that Xestus is the name of the Greek god of sea and ocean currents who helped to guide the Argo on its journey. Well done Paul, and many many thanks.

Onwards and onwards.
This week's animal of the week was brought to my attention by a friend with whom I went to see Feist last night, a grown man wearing a lovely knitted jumper with the shape of a shark emblazoned across it in red, taking up a good fifty percent of the area of the jumper frontage. With its broad head and tapered streamlined body, its stiff projecting pectoral fins and menacing pose, I recognised the animal instantly... but that's enough about my friend.

Unfortunately for my friend, his jumper had been attacked by this week's animal of the week Tineola bisselliella (common clothes moths). These little blighters seem to be plaguing people a bit this year, as this was not the first assault on a wardrobe I had heard of this year, not by a long chalk.

Clothes moths used to be important pests, but increased use of manmade fibres, less-humid housing due to central heating, more dry cleaning, and greater use of insecticides have led to a decline in damage. Nevertheless, when they do get in among your woollens, furs, and natural fibre carpets their effects can be most vexing.

The entirely anecdotal and unfounded plague of moths this year, the presence of which I have inferred from a few accounts of acquaintances and things written on internet forums (that's what a year of postgraduate science education does for you) is likely due to one of three things: global warming leading to a very wet summer, terrorism, or government conspiracy (an umbrella term for the previous two options anyway).

My love for all the animals (except slugs) is well documented, so I'd like to encourage you all to look on the bright side of common clothes moths. If you clean out your cupboards and vacuum thoroughly you should be able to control an infestation. The moths are particularly attracted to clothes with remnants of perspiration, food and drink spillages, or urine on them, so perhaps there are one or two lessons to be learned from an infestation anyway. And failing all that, because they start with the most accessible bits of your clothes, the holes they make in the cuffs of your jumper are ideal to put your thumbs through when the inevitable second grunge revival strikes (the first grunge revival occurred when I had an infestation of clothes moths in East Finchley in 2001 [ie, the heyday of emo]).

Many thanks,

Peter Hayward
Head Keeper
Animal of the Week

ps, having struggled this far through AOTW, you will be shocked to learn that I am both an editor and a writer. Now that my MSc is over and before I have to return to selling what god gave me for £20 a pop above a Soho hairdressers, I am looking for freelance/temporary/permanent work. Do you know anyone who needs any editing and/or writing done? If so, please let me know.

Animal of the Week -- September 17, 2007

Hello one, Hello all

Many thanks for your responses to my previous missive, it seems that many of you hold cartoon series Dungeons and Dragons in great affection, more than one of you seemed to harbour, er, special fondnesses for particular characters.

Anyway, enough of that nonsense. A recurring theme over the past month or so has been that of animal alphabets, first a very dear friend comes to visit and she is wearing an animal alphabet T shirt, then the following weekend I go to the Green Man festival, I turn up the day after most of the people with whom I was staying, and they tell me that the night before they had been playing a game in which participants have to name an animal starting with each letter of the alphabet.

Both on my friend's T shirt and in the Green Man naming game two letters caused particularly problems, not the Q and the Z as you might expect—quaggas, zebras, zorillas, quillas, zanders, quetzels, and zebu provide plenty of options—but surprisingly U and, perhaps predictably, X. Now, where previously in such pastimes you had to make an exception for a fictional unicorn for U, you have the previous animal of the, erm, week, the uakari. But what about that pesky X?

At the Green Man festival an ever-astute Welshman recalled the X-ray fish, a small aquarium fish with see-through skin (the kind of skin you can see through), and that was going to be this week's animal...until I spotted another fish with a name beginning with X. This week's animal of the week is Petroscirtes xestus (xestus fangblenny, bearded sabretooth blenny). Blennies are small coastal fish, and this species is no exception, unremarkable and typically brown. Fangblenny just sounds so oxymoronic, the equivalent of "werehamster", "vampire tit", "The Sloth of the Baskervilles", or "murderous death sprat of terror".

There's not much more to say on the matter of the xestus fangblenny. I have no idea what xestus means, do you? Answers in an email please, the prize being an honourable mention in next week's AOTW.

Peter Hayward
Head Keeper
Animal of the Week

ps, having struggled this far through AOTW, you will be shocked to learn that I am both an editor and a writer. Now that my MSc is over and before I have to return to selling what god gave me for £20 a pop above a Soho hairdressers, I am looking for freelance/temporary/permanent work. Do you know anyone who needs any editing and/or writing done? If so, please let me know.

Animal of the Week -- September 03, 2007

HELLO! HAI! HOW ARE YOU ALL?

I do hope that everyone has had a marvellous August, I know I have. So much has happened: floods, fires, new Harry Potter film and book, another series of Big Brother over, the baiji extinct then not extinct, but probably dead in the water whatever... It has been so very long, I am not sure I know how to do this anymore. Please forgive me if this is a little ropey, I am sure I shall be back up to speed next week.

Anyway, this week's wizard of the week is Venger from the classic TV series Dungeons and Dragons... Venger was a pasty-faced cross dresser who in an act of rebellion as a teenager filed his teeth and started wearing a cape. He never grew out of the goth phase.

Lording it over the evil and corruptible characters of The Realm, Venger repeatedly tried to trap, trick, crush, or magically imprison Hank, Diana, Presto, Eric, Bobby and the useless unsteady bint with the invisibility cloak to rest from them the gifts bestowed on them by Dungeon Master to help them navigate their way home. Venger was thwarted at every turn, which given that his foes were a bunch of kids who arrived from another dimension on a fairground ride who didn't know how to use their magical weapons and, in some cases, could barely stay upright for more than five minutes suggests to me that he had the wizarding skills of a teaspoon.

Venger's mortal enemy in The Realm was a five-headed dragon called Tiamat, named after a goddess of Babylonian mythology. Whenever the two squared up Venger would, almost without fail, flee in the knowledge that whatever artifice he could come up with was no match for Tiamat's powers of burning and freezing and speaking like Bea Arthur on helium.

Most of Venger's problems likely stem from the fact that his father was the walking nutsack, Dungeon Master. An interfering gnome-wizard whose main power was to appear and disappear when walking behind rocks, Dungeon Master was supposedly trying to help the kids find their way home and stop Venger getting hold of the magical gifts he gave them. Although given his purported wisdom, he should have realised that if they were ever going to get home, Bobby and his mates needed to ditch the bloody unicorn for a start.

Venger was the name of the car on the story on the sleeve of Kenickie's 1995 Skillex EP. So there we are, wizard of the week, Venger....

... what?

... animals?

... really?

... why would anyone do that?

A what? Oh, right, a zoologist, uh, I thought that was all a dream... ... OK... have this bum-headed monkey... Cacajao calvus (bald uakari). The name uakari is believed to be derived from an Amerindian word for Dutchman.

See you next week lovelies!

Px

Animal of the Week -- July 30, 2007

So, I'm thinking, I need to do animal of the fortnight, and in the UK at the moment it's all great white sharks off Cornwall. Are the maneating leviathans really there? Possibly, probably not, the sharks seen are more likely to be basking sharks (bigger than great whites but filter feeders), porbeagle sharks (smaller than great whites, but large and fast, though nothing to worry about), or mako sharks (larger than a porbeagle, smaller than a great white, but large, fast and fierce, although not a maneater). And I am looking up information about these sharks, and then I spy the name of an animal of which I had not heard before, Alepisaurus ferox (longnose lancetfish)

Now, lancetfish are large predatory fish that eat smaller fish and small swimming crustaceans. They are considered pests by tuna fisheries where they take the bait from hooks and their watery flesh is not considered worth eating.

Quite unremarkable really, however, I was tickled by the name because it includes my former employers, The Lancet, a medical journal. Appropriately for a fish that shares its name with the august medical organ renowned for its "stand on several important medical issues - recent examples include criticism of the World Health Organization, rejecting the efficacy of homeopathy as a therapeutic option and its disapproval of Reed Elsevier's links with the arms industry [Source Wikipedia]", lancetfish have sharp teeth, hunt by ambush, and have a big mouth.

Their insipid watery flesh is, I would like to stress, less like the contents of The Lancet. And as for their purported aphrodisiac powers, well, I would be too abashed to comment.

Please forgive me this minor indulgence, it's a bit of a rubbish AOTW I know. But there you go. Also, I am going to take the next few weeks off. A small matter of a dissertation and shabby work ethic mean that I am likely to need all the minutes I can find. But AOTW will return per week and reinvigorated in September. I wish you all a lovely summer.

Animal of the Week -- July 16, 2007

Well, it's that time of year again, when an afternoon outside becomes a constant battle against foe whose endless onslaught is like nothing seen outside a Lord of the Rings battle scene. No sooner have you shaken one from your hair than another lands in your cleavage, and when you've picked that out, you find three have landed in your drink/on your ice cream/in your mouth. And what is this haphazard winged plague of summer? Lasius niger (black garden ants), that's what.

You may wonder what triggers this aerial onslaught, when generally ants aren't that noted for their flying, and are most annoying for dying in your sugarbowl. Our insect tormentors are either queens, the most prominent fat ones, or males, the little ones that you see but don't really mind about because they're much less custardy. This is the only time that the ants will fly, hence their lack of proficiency.

On this, their nuptial flight, the males and females will mate, and with the juices of the male safely apportioned, he will die, the queen will lose her wings and tunnel underground and begin to lay eggs. The fertilised eggs hatch and the larvae become female workers. Throughout the rest of the year the colony swells as more and more workers hatch out of the never ending supply of eggs from the distended and immobile queen. The colony spreads further and further looking for food, getting into your cupboards dying in the threads of your jam-jar lids, wandering off with the contents of picnic baskets, and getting in your pants. What else do ants do?

As summer approaches, the workers decide it's time for the success of the colony to be spread even further, and they select some eggs (still fertilised by the product of the nuptial flight) to raise as dispersing queens, and the queen lays some unfertilised eggs that will become males. Triggered by cues of daylength, temperature, and humidity with astounding and fearsome synchronicity colonies all over an area crack open and the winged horde takes flight. The mass eruption means that queens of one colony might mate with males of another rather than with their own brothers.

The flying menace some years reaches such proportions that they clog air-conditioning and trigger mass congregations of sea gulls and swallows, which come to feast on the glut. Humans deal with the event by flapping, moaning, squashing and beating them from the sky with badminton racquets. I say let them be, they'll be gone as soon and as suddenly as they came.

One downside of black ant for the gardeners among you is that they farm aphids, protecting them from predators while harvesting a sticky secretion called honeydew (the nasty smut that gathers on a car parked under a lime tree). In the picture, a black ant is carrying an aphid in its jaws.

Animalof the Week -- July 9, 2007

I worry that I am starting to sound a bit like a countryside diary of late, what with my tales of cockchafers, pigeons, swifts, and other things that I see as I pootle around London, such as piranhas and golden moles. So this week I am going to resist the temptation to regale you with the tale of peregrine falcons spotted over Clapham on Sunday morning.

Instead, this week's AOTW is something a slightly larger and much rarer bird of prey. Rarer to the extent of being extinct, for about 6 million years. This week's Animal of the Week is Argentavis magificens (giant teratorn). This relative of the living condors was the largest flying bird ever to have lived. With a wingspan of up to 8 m (28 feet) and weighing possibly as much as 100 kg (220 lb). For reference, a wandering albatross has a wingspan of 3.83 m, modern day Andean condors have a wingspan of 3 m and weigh up to 12 kg, and the heaviest flying birds, European (AOTW, April 11, 2005) and Kori bustards weigh no more than 20 kg.

The teratorns were large birds of North and South America that lived from the Miocene to the Pleistocene (15 million to 11 thousand years ago), and this species survived in Argentina from 8–6 million years ago. Other teratorns were not much larger than the modern-day condors, but Argentavis magnificens was truly a monster. People have speculated whether and how such an enormous bird could fly, but the imprints of feather attachments on the birds wing bones (an upper-arm bone would have been the same length as a whole human arm) show that they had flight feathers. Fortunately, the lack of the Andes in South America at the time these birds lived meant that strong westerly winds whipped across the continent, which would have helped the bird take to the sky with a little running around and flapping.

Whether these birds scavenged or hunted is also a bone of contention. Other teratorns almost certainly hunted, because they resembled eagles, which hunt, much more than they did their close relatives condors, which scavenge. But could a bird this size be an active hunter? Perhaps it did a little of both, driving the marsupial lions away from their kills of giant sloths or weird camels with trunks (South America was different then) when the opportunity arose, and when it didn't, swooping down on animals up to the size of hares and small dogs, picking them off the ground, and swallowing them whole.

This week's image may not be entirely accurate. Certainly Argentavis magnificens would never have soared over the heads of Japanese cartoon characters, or any humanoids for that matter. Furthermore, the head may not have been bald. But there you go, needs must when you need to steal a picture.

What a bird!

Animal of the Week -- July 2, 2007

What a week for news!

On the plus side Tony Blair has gone, and although ballots were absent in the selection of his successor, and East Timor have held their first public democratic vote, and although the count is slow, the process looks good. On the downside, floods have ravaged the north of England and various US states, Wimbledon has barely started, the UK is on the highest state of terror alert after some deluded fanatics tried to car bomb London and Glasgow, and perhaps worst of all, to compound all the misery in the world that I have not been able to summarise in my brief introduction so far, the Spice Girls have reformed.

Thank god that news about animals tends to be more neutral, like that about this week's animal Pygocentrus nattereri (red-bellied piranha), in fact, this news is just about the best and most complete image overhaul sine Paris Hilton vowed to invest her time, money, and, er, intellect for good on her release from jail. For researchers now claim that piranhas are not the frenzied, blood thirsty, pack predators capable of stripping a cow carcass in minutes, but rather their shoaling behaviour is driven by cowardice in an attempt to avoid predation by river dolphins (AOTW, Feb 21, 2005: http://animal-of-the-week.blogspot.com/2005_02_01_archive.html), caimans, and the enormous fish that live in the amazon.

Now, I can't find out the exact species of piranha studies, but at red-bellied piranhas are some of the most aggressive, and certainly not the sort of fish immortalised in the "One, two, three, four, five, once I caught a fish alive" nursery rhyme, which would no doubt have a different ending if it were.* Most piranhas are vegetarian anyway, and the most aggressive ones, such as this and its close relatives, are likely to have been the subject of the study, if not, why bother?! Apparently even these typically only hang around in small shoals and prey on small fish, carrion, or bits of larger fish. According to the researchers, they only form large shoals when the waters recede and they are more prone to predation, and not for the purposes of hunting large animals and stripping the flesh from captured secret agents at the behest of Ernst Bloefeld.

Of course, you may have seen demonstrations of these voracious fish stripping a chicken carcass to bare bones in seconds, and they will do that, but only when kept in small tanks and deprived of food. Despite this image makeover for the piranhas, you still can't keep them in aquaria with smaller fish, they'd eat them.

*One two three four five
Once I caught a fish alive
Six seven eight nine ten
Then I let it go again
Why did you let it go?
Because it bit all my fingers off and I didn't have a choice.

Tak tak,

Animal of the Week -- June 25, 2007

Being a little UK and summer centric at the moment, I know, but I am like some weird child who can only think about what he sees, you know that by now.

This week's animal of the week is another sure sign and sound of summer, so tightly associated with the season in my mind that just thinking about them gives me a tan, which, given the weather here at the moment and my lack of holiday funds, is the only way I'm going to get one this year. This week's animal is Apus apus (common swift).

Flocks of these most aerial of all birds wheeling over the village squares, town halls, and city skyscapes screaming and careening in pursuit of airborne plankton are a common and stunning sight across Europe. Appearing in early May and remaining until late July. Outside their brief visit to these temperate climes, swifts fly thousands of miles to sub-Saharan Africa.

Common swifts live nearly their whole lives on the wing, they are even able to sleep in flight. Their nests are made from floating feathers, petals, and light grasses gathered on the wing and glued together with spit, and all their food -- small insects and floating spiders -- is caught in flight, scooped up in kamikaze dives near the ground or sifted from the atmosphere so high up that from the ground the birds become tiny crescent-shaped specks. Swifts never land on the ground, only punctuating their endless flight with occasional breaks clinging to vertical surfaces with their tiny feet (apus means no feet) and their brief nesting period.

Although they look like swallows and martins, and have similar migratory patterns, swifts are more closely related to hummingbirds than any other birds, weird. You can distinguish swifts from swallows and martins as the former are slightly larger, and their wings are more curved, appearing as a perfect sickle. Swifts also never land on the ground, only punctuating their endless flight with occasional breaks clinging to vertical surfaces. Their exhilarating, screaming call also sets swifts apart. One swallow may not a summer make, but for me, a flock of swifts, certainly helps.

I think my contemplative mood today is evident, so you can do your own swift swallow martin innuendo yourself. Oh, there you go then.

Animal of the Week -- June 18, 2007

Hello!

It was playing on my mind recently that I had not seen any of this week's animal of the week yet this year, despite it being associated with the month of May and only really being active in European parks and gardens during the early warm summer months. But then, there I was, hanging around the flower gardens of Kennington Park as dusk approached this weekend when a series of rustling, the occasional bumps, and random banging announced the arrival of several of the large and hairy Melolontha melolontha (cockchafers).

Cockchafers (no sniggering at the back), are large beetles that emerge in May and can be spotted flying rather haphazardly whirring through the sky and bumping into trees, buildings and people around green spaces, and feasting voraciously on plant material, particularly oak trees, but also crops, until the end of July. They are particularly active late in the day, so, for example, in London, Hampstead Heath as dusk approaches is a good place to find cockchafers.

Their larvae spend 3 years eating roots and tubers growing to a size of 5 cm, they pupate in autumn, but the adults overwinter in the soil emerging in May. Until recently, cockchafers sometimes reached plague proportions, causing devastation to crops, typically in 30 year cycles. The main measure to combat them would be to collect the adults and disrupt the breeding cycle, this tactic led to inventive recipes for sugarcoated cockchafers and cockchafer soup. Although largely ineffective, this method was far more successful than that employed in Avignon in 1320, when cockchafers were tried in court and ordered to retreat to a specially designated area!

Neither legislation nor culinary endeavour eventually brought the cockchafer under control. The introduction of chemical pesticides decimated their numbers, but in recent years they have had something of a resurgence and parks, gardens, and open spaces across the UK and Europe resound with the sounds of the crepuscular activities of cockchafers.

At about 2.5 cm long and being such a large and noticeable beetle, they have fired the imagination of people, and in the UK alone they have a great many names: not only the suggestive cockchafer, but also the half-right "May bug", the conflicting "July beetle", the unbelievable "spang beetle", and the Spoonerism-tastic "billy witch".

Animal of the Week -- June 4, 2007

After five whole months in exile following the festive avian glut at Christmas, the ornithologists, twitchers, and bird fanciers among you might be pleased to hear that this week's animal is an ave. Although you may be less excited to hear that this week's animal is actually Columba livia domestica (domestic pigeon, feral pigeon, rat with wings).

Now, the coincidence is striking: this time last year I related to you a tale of bloody murder http://animal-of-the-week.blogspot.com/2006/06/animal-of-week-june-5-2006-islington.html featuring a herring gull, a pigeon, and the Regent's Canal. I have not seen anything like it since, that is, not until yesterday evening. Stood in the waterfront bar of King's College Union attending a gig by Australian wonderband Architecture in Helsinki and overlooking the Gormley dotted skyscape of the Southbank, my eyes were drawn to a commotion in the sky above the river by Gabriel's Warf. What first appeared to be a dogfight among a group of lesser black-backed gulls was actually aerial pursuit. Barrelling along in front of the five or six gulls was a pigeon -- scraggly, dirty, unloveable, and unloved. Diving this way and that, skimming the treetops, hurtling towards buildings in a deadly collision course before wheeling away at the last minute, the little thing was desperately trying to shake off its pursuers. The dastardly gulls matched the pigeon's every move, frequently seeming to catch up with the pigeon trying to nab him, jab him, tab him, grab him, but never quite getting more than the tip of a tailfeather.

From Blackfriars to Waterloo the birds shot, from north bank to south. Disappearing from sight for a few moments, they would dramatically reappear from above outside the gallery windows at King's Union. I, and other interested onlookers (ie, the kind person I was with who was too polite not to feign interest), watched the dramatic chase for a few minutes. The pursuit was lost to sight finally, but a flock of gulls reappeared shortly after, no pigeon among them, so I assume it escaped.

So, I am pleased to report that the pelicans and the gulls that have turned pigeon killers don't always have it their way. The escape of domestic pigeons has made this species perhaps the most widely distributed non-migratory species of bird, being populous among many cities, with plenty of places being famed for their large flocks. Descended from rock doves, although there are a variety of domestic forms (see the Jacobin breed in the pics), most feral versions have reverted to a rock dove shape with varied colour. They might be a pain sometimes, yes, and being crapped on one cannot be considered lucky, but none of their badness is their fault, they just do what comes naturally in the unnatural settings created by people with all the ideal nesting sites and plentiful discarded food. Talk of pigeons fouling the street occur in Mesopotamian scripts of 4000 years ago; and in classical Rome, large colonies were plundered as a source of fat young pigeons, squabs, for food. They are remarkable animals, adapting better than almost any other to the manmade environment.

One of the domestic pigeon's most famous skills is its ability to navigate home over great distances, up to 1000 km, of unknown terrain. This trait was used to great effect during various wars, when the birds were used to send messages from the frontlines, and a couple of pigeons have been awarded medals for their contributions to war efforts. A lesser known ability that people have claimed for pigeons is an ability to distinguish between impressionist and cubist paintings. In 1995, scientists encouraged a pigeon to sort artwork, after a little training, in which pigeons were rewarded with food for pecking at Picassos but given nothing for pecking at Monets, they soon only ever pecked at Picassos. When new paintings and other artists were included the pigeons could still distinguish between the two schools. And like the punchline to some appalling 1970s sitcom joke in which a dowdy conservative tries to get to grip with modern art, when the paintings were turned upside down, the pigeons didn't know what to do with the impressionist work, but continued to behave as ever with the cubist pictures.

Big up the pigeons!

Animal of the Week -- May 28, 2007

Sorry, sorry, sorry.

Animal of the Week? Animal of the Fortnight more like!

Still, just time for one more marsupial for May. And this week's is a weird but beautiful creature. It's Notoryctes typhlops (southern marsupial mole)!

Like moles of the northern hemisphere and the golden moles of Africa, marsupial moles are extremely highly adapted to a burrowing (or fossorial, to use the technical language) lifestyle. Like the others they have big shovel-like claws on their front legs, hard nose, fused neck vertebrae, and they are blind because where their eyes should be, there is merely skin and lovely cream coloured velvety fur.

Living in desert environments, these moles swim through the sand searching for worms, witchetty grubs (http://animal-of-the-week.blogspot.com/2006/11/animal-of-week-november-13-2006.html), other larvae, and the occasional lizard. Another cunning adaptation to the fossorial lifestyle, this marsupial's pouch (or marsupium, to use the technical language) points backwards.

Once, the two species of marsupial mole were thought to be monotremes related to the platypus and echidna, not marsupials at all. Until recently their incredibly specialised form confounded taxonomists who were unable to work out how they were related to other marsupials. But actually these moles are most closely related to carnivorous marsupials such as numbats, Tasmanian devils, quolls, and the recently extinct Tasmanian tiger.

So anyway, this is the marsupial mole, it is animal of the week, and I am off now.

Byeee!

Animal of the Week -- May 14, 2007

And let it be known that May 2007 was the month of marsupials. For this week's animal of the week is Monodelphis domesticus (grey short-tailed opossum, or grijze of gewone kortstaartopossum for my Dutch readers).

Hopping continents from last week's Australasian representative of the marsupials, this wee mouse-like marsupial hails from the forests of Brazil and Bolivia. Arboreal in habit and unremarkable in many respects, the grey short-tailed opossum is most notable for being the first marsupial to have its genome sequenced (published in the journal Nature [I have obligations]). A popular laboratory animal, scientists hope that knowledge of its genetic make up will provide insights into how its babies, which are born at about the same developmental stage as a 40 day old human foetus, manage to survive simply clinging to the teat of their mother without an immune system and how the young repair their spinal cords if they are severed. Comparison between this genome and that of other sequenced mammals, such as human beings, chimpanzees, and mice will reveal some of the major differences evolved since the divergence of marsupials and the rest of us some 180 million years ago.

Given that the word marsupial is derived from marsupium, it seems a damn cheek that these animals don't have a pouch -- the young simply hang from their mothers' teats. The word opossum comes from the native-American Algonquian word "wapathemwa" for the Virginia opossum. The word the comes from the word.

And for the DNA freaks amongst you here's a joke:

ACGAAATTTATGGGCACACGGGGCGCAATTGGTTTGGCCCAAACCACACATTTGT
TTCTCCCGAGTCCCGAGATCACATTCGAGCCTCTCACTACTAGCAGACGACGACT
ACATATACT

ORF ORF!

Animal of the Week -- May 7, 2007

Although Andrew Motion was quaking in his boots when he first saw last week's effort, he was quickly relieved when he spotted my egregious error in suggesting that the people conned in the poodle scam had been given back their mediaeval instrument rather than their "loot". I would like to say that I spotted the error myself, but if I told you that I would be a lyre.

Crashing on, this week's animal of the week is Dendrolagus mbaiso (dingiso, bondegezou). This cute little bundle of loveliness is a tree kangaroo from the Western New Guinea region of Indonesia. I always found it bizarre that a kangaroo should climb a tree, but dingisos are doubly weird as their ancestors came back down from the trees and they are largely terrestrial, spending little if any time in trees. Such evolutionary wrong-headedness would typically make the kangaroos an easy target for human hunters. Fortunately, the local Moni people regard dingisos as ancestors and do not hunt them, even though the kangaroos can be coaxed from a tree with a handful of succulent leaves and a noose easily slipped around their neck. When they encounter human beings, dingisos wave their arms in the air and whistle like pie-eyed new-rave devotees in New Cross, and the Moni view this as a greeting from their ancestors. Sounds like a partnership made in heaven for the Moni and the dingisos.

Evolving in a land without other mammals, tree kangaroos fill the niches generally taken by monkeys. And their commitment to this must be viewed with some respect. Fitting huge hind legs developed for bounding across open plains up a tree is not easy. Dingisos have, however, readapted to life on the ground, whereas other tree kangaroos have shorter hind legs and very long tails, the reverse is true of these lovely black and white fellows. Their striking pied fur is very dense, an adaptation to their life at high altitudes where the temperature can drop to below zero most nights. I salute these weird critters: the black and white, new rave, ground-tree kangaroos.

Animal of the Week -- April 30, 2007

AOTW Ovis aries (domestic sheep)



The Japanese Poodle Fleece a poem by Peter Hayward age 28 and 3/4

In Japan, we were told, by the tabloid fold
that sheep are poorly known
And that a poodle would vend for a great many yen
If properly clipped and mown

Spotting a scam, an unscrupulous man,
reported the Sun and Express,
trimmed a woolly white sheep to have pom pom feet
for a Japanese star actress

For twelve-hundred pound she bought her hound
so she thought, so rare and so fine
But of the Pedigree Chum her dog would eat none
Since its tastes were distinctly ovine

The rogue we are told, went on and sold
Pets to geishas and makers of noodles
For each one in turn a tidy profit he'd earn
As he was passing off sheep as pet poodles

The fabled actress found her "dog" in distress
As long toenails impinged on its moves
When she went to the vet, a surprise he did get
"These are not claws, they are hooves!"

The papers report that the rogue was then caught
And put in a cell with a lock
Those who were duped, got back their loot
And the sheep were returned to the flock

But the next day it is stated the tale was fabricated
Not a word of the story was true
Never there was a sheep dressed as a dog
Not a ram, not a lamb, not a ewe

Even though it was fake, the story was great
Spreading grins from ear to ear
And if you're a dog or a sheep, expensive or cheap
They'll eat you both up in Korea

*I would like to say sorry for any racial stereotyping/myth propagation -- I hope no-one takes offence and sincerely apologise if you do*

Robins not nightingales -- non AOTW

Picture this, London 1998, in my second year as a Zoology student at UCL I lived in the delightful NW area of Kilburn, it's delightful now with many nice bars and eateries and the marvellous music venue The Luminaire, it wasn't so nice then, and even worse to the north, appropriately up Shoot Up Hill, was the borough of Cricklewood -- or gangster and skag central as it was then.
One night, on may way back from, erm, some late night study, I fell asleep on the night bus only to wake up in the aforementioned Cricklewood. Now, it was late, buses were infrequent, and I was, erm, confused. My failsafe way to navigate home was by the sound of birdsong because there was a robin that sang all night outside my window.
The clear light of day made me realise that this was a foolish thing to have done as there must have been thirty or more robins along my walk home, nonetheless, the clear light of day found me curled up in my bed. For I had successfully navigated home by the sound of the robin's song.
Thank god for noise pollution during the day, for this is the latest explanation for why robins sing throughout the night. Many people think it is nightingales, but you only get them in Berkley Sq, they are too posh for elsewhere in London.

Sumatran Rhino on Borneo -- not AOTW

Well, you know what, I am going to start doing this more often. Seems silly that that crazy rhino story is announced and I can't comment until Monday. So, it may still be AOTW next week, it may not be, but here is a link to that video of the Borneo subspecies of Sumatran rhino (Dicerorhinus sumatrensis harrissoni -- eastern Sumatran rhino).
As editors at The Lancet will know, Sumatran rhinos are the hairiest of all the rhinos. Even these erudite and learned folks may not know that these rhinos are the closest living relatives of the woolly rhinoceroses that inhabited Eurasia during last ice age.

Animal of the Week -- April 23, 2007

Happy Saint George's Day Ani-freaks!

What did you have for breakfast this morning? Perhaps you had some muesli with dried raspberries and strawberries in it, perhaps you had some wholewheat cereal with soy milk, perhaps you had some toast and honey, you might also have popped some bee pollen to take on it's putative benefits, or have you moisturised with a royal jelly face cream, or maybe you even did a little polishing with beeswax (don't you ever say that I don't know my audience). Well, if so, you should spare a thought for this week's animal of the week and cherish the experience, because, it is a tough time to bee Apis mellifera (western honey bee).

Having been ravaged by the vampire mite Varroa for the past 20 years or so, the primary pollinators of apples, soft fruit, beans, and many wild flowers are now facing new threats. Across the USA and Europe, beekeepers have anticipated the waking of their hives, but up to 60% have remained silent, and under investigation have turned out to be ghost hives, food in the cells, young bees abandoned, but no sign of the adults. No one knows the cause of this Colony Collapse Disorder (CCD), although pesticides, GM crops, global warming, and even electromagnetic radiation have been proposed as possible causes. To test the last of these theories a US scientist placed base units for cordless phones in beehives and found that the radiation from them stopped bees navigating home. He also found answering the phone a painful experience and that there was a terrible buzz on the line. Although he never forgot where he left the handset.

And as CCD sweeps the USA and Europe, Europe's bees face another new threat, Vespa velutina, the Asian hornet. At 4 and a half centimetres long and with a wingspan of 6 centimetres, this hornet has swept across France since being introduced a couple of years ago. A group of 30 hornets can kill 30 000 bees in a few hours, biting them in half and stinging them with their powerful toxins. They leave a pile of bisected bees at the hive entrance and plunder the honey bee larvae to take back to their own for dinner.

Our western bees could learn a thing or two from their Asian cousins, Apis cerana. Threatened by a hornet, a group of bees cluster around the giant hornets creating a ball and start to vibrate. The vibrations which they normally use to regulate temperature in the brood chambers can raise the temperature of the bee ball to 46 degrees centigrade and cook the hornet at the centre. Neat, eh?

So, it's not good news for western honey bees right now. Stockpile honey and don't expect bumper crops of many of your favourite summer fruits.

See this video for the outcomes of hornet attacks on European bees and Asian bees (Bees 1, Hornets 1):

It bee mighty entertaining.

The Coterie of Zombies: All I do the whole day through is dream of you!

The Coterie of Zombies: All I do the whole day through is dream of you!

Animal of the Week -- April 16, 2007

The observant among you will have noticed the absence of Animal of the Week last week. For this I am terribly sorry, I was busy with Easter and then the internet went off-line all over the world.

To recompense for these events beyond my control, this week's animal is a monster, or rather a DINOSAUR! YAY! And not just any old dinosaur, oh no, for this week's animal is the king of the dinosaurs Tyrannosaurus rex.

I received a concerned message a couple of weeks back about the discovery of soft tissue in a T rex bone. Did that mean they had DNA? Were we going to start cloning T rex? Now, I had heard nothing of this, but a little investigation turned up that during a 2005 excavation a T rex bone had been broken and inside there appeared to be some soft tissue. Researchers originally assumed that the soft tissue was some weird mineral structure, because actual biological molecules could not possibly survive more than a million years let alone the 68 million years since the T rex had died. Or could they?

This week, the journal Science revealed a partial sequence of a protein from T rex bones found at the Hell Creek formation in Wyoming and Montana. Showing that biological molecules can survive for enormous lengths of time. When compared with other sequences of the same protein for living animals, the T rex was most similar to chickens.

T rex was alive as the reign of the dinosaurs came to an end, 67 million years ago. At 13 metres long and 5 metres tall it was one of the largest land predators to have ever lived. But not the largest. That record currently belongs to Giganotosaurus, which was likely almost 2 m longer and perhaps a tonne heavier than T rex, which lived some 30 million years before T rex in South America. The size of these huge carnivores means that they may not have been the swiftest of creatures, which makes people think they may have been scavengers rather than hunters. However, their prey were likely huge and even slower, so a lack of speed, agility, and grace would not have been necessary; however, they certainly weren't born to boogie.

But anyway, what with all this protein, might we be cloning T rex into chicken eggs any time soon. Unlikely, the protein is probably more stable than the DNA that would be needed for cloning, and even that was in tiny fragments. So sadly, there won't be theme parks populated by dinosaurs and offering T rex rides any time soon, but given their similarity to birds shown by this study, you might like to ride a white swan instead.

NB, the attached image is of course completely inaccurate, I am sure you don't need me to tell you that T rex would not have been able to stand upright as its hips and neck would have dislocated. They would have stood with their backs parallel to the ground.

Animal of the Week April 2, 2007 -- Troglobites

Hello,
For a change, this week's animals are unnamed. Not because I am being lazy, I am not in charge of that sort of thing, rather because I can't find the names of any of them, and they are five species! They are the five species of troglobite that have caused the Western Australia Environmental Protection Agency to halt the construction of a multibillion dollar mine at Pannawonica, in the north-western region of Pilbara.

You would be forgiven for thinking that troglobite is just another of my gross spelling errors that litter these mailouts like rare insect species over a planned development site, but no, I mean neither troglodyte nor trilobite, but troglobite: any animal adapted to live solely and exclusively within caves that can never leave. Troglobites typically have advanced senses of touch and smell but a massively reduced sense of sight, with most being totally blind. A common adaptation among troglobite spiders, such as those in those in question here, is the loss of eyes and the adaptation of the front pair of legs to become long feelers (as seen in the picture).

The troglobites halting the Robe River, a subsidiary of Rio Tinto, planned mine are spider like creatures, none bigger than half a centimetre in length, but unique to the site and not found in a neighbouring reserve protected from mine exploration. Troglobites feast on traces of organic material that drift into cave systems from the world above or algae and other microorganisms that survive within their cave systems, or in the case of spiders, other troglobites. Unable to survive exposure to direct light as they have no protection against UV rays, these troglobites would have no hope of colonising a new cave system. Every time a cave tropical system is investigated, a new set of these creatures is discovered, fish, salamanders, crickets, centipedes, insects, and shrimps have all several times moved into subterranean homes.

With iron ore set to run out in their existing mines in Australia in the next five years, Robe River will appeal hard for the mines to be built. So these spiders may not be long for this world, so I salute you little nameless, eyeless buddies. Enjoy what time you have left licking algae from the rocks and eating blind beetles in your tiny sunless world.

Animal of the Week March 26, 2007 -- Beautiful punctuation

Regular readers of the animal of the week mailout, particularly last week's effort, may be surprised to discover that I was once, and to most intents and purposes (earning money while I study to become a taxonomist) still am, a copyeditor. In recognition of the fact that I do not always create the most grammatically pleasing of emails, this week's animal of the week is Polygonia c-album (comma).

A comma is a beautiful butterfly of Europe, Asia, and north Africa. Orange and brown on the upper side of the wing, with wings folded, a brown underside with a small white mark resembling a comma (hence the name) is revealed. The wings have a crinkled edge so that the adults resemble a fallen leaf. The caterpillars are brown with a white mark on their posterior so that they resemble bird droppings. Now that's camouflage.

Anyway, bad punctuation, misspelling, appalling puns, abject failure to inject humour or fact into a supposedly entertaining and informative mailout, I am guilty of all of these things. But at least I did not insert unnecessary hyphenation into the scientific name of a species named after a punctuation mark... never rely on a taxonomist for a joke.

Animal of the Week March 19, 2007 -- New leopard

Well, it's fast turning into mammal of the week around here, I was very much going to not have a mammal as animal of the week, but then a new species of beautiful big cat is named, so this week's animal of the week is, of course, Neofelis diardii (Bornean clouded leopard).

Clouded leopards are members of the group of big cats including snow leopards, tigers, leopards, lions, and jaguars, although they are generally thought to be the cats that diverged from the others in this group earliest. Previously the cats on Borneo and Sumatra were thought to be a subspecies of the Neofelis nebulosa, but genetic studies suggest that they diverged from the mainland cats over 1 million years ago when they spread out into the Malay archipelago before it was divided by the sea, and they are distinct enough to have species status themselves.

Although the clouded leopards are small big cats, on Borneo they are the largest predator, on Sumatra, the few tigers that remain put them firmly into second place. Despite their diminutive stature they are finely honed predators and along with jaguars, they have, relative to their body size, the strongest bite of the big cats. Clouded leopards also have the longest canines relative to body size. What all this means, I know not.

Should you be faced with having to tell the two species of clouded leopard appart and you do not have the facility to sequence their mitochondrial genes, the Bornean clouded leopard is much darker than the mainland species and has spots within its cloudy markings. It will also be on Borneo and Sumatra and not on the mainland.

So there you go, what does this new speices status mean? It means more funding for conservation efforts, and more awareness for plight of Borneo's forests threatened by the lumber and palm oil industries. And what does that mean, that means that maybe this isn't really a separate species at all, just a subspecies as previously thought, raised in status by duplicitous conservationists. It all depends whose side you're on really.

Animal of the Week March 12, 2007 -- Come to the tea party

So, as it is now March, this week's animal of the week is Lepus europaeus (european or brown hare). The March Hare, a sartorially elegant guest at the famed tea party of Lewis Carroll's Alice's Adventures in Wonderland. Brown hares rarely, if ever, wear jackets or, for that matter drink tea. Rather, they bomb around the fields of northern Europe and western Asia as speeds of 70 kilometres per hour.

At this time of year, you may well see hares careening around meadows, leaping over one another, and engaging in the famous boxing behaviour. Although for many years, people believed these sparring couples were males competing for access to females. But turns out, that they are females fending off unwanted attention too early in the breeding season. When the females are ready, they stop boxing, go at it like rabbits (not very often, just quite similar in shape and mechanics), and a few weeks later they give birth to their young, leverets, in a small hollow or flattened patch of grass, a form, on the surface, not in a burrow.

Keeping a low profile for the main part of the year, their sudden appearence in spring and mysterious habits for the remainder of the year mean that hares have featured prominently in European folklore and religions. The pre-Christian English goddess Eostre whose festivals were celebrated in Spring, could transform herself into a hare, that is if she ever existed, and wasn't a creation of the Venerable Bede's. The association of hares with Eostre's festivals and with the Ostara festival in pagan Germany may be the origins of the Easter bunny.

Maybe they ain't. The phrase "mad as a March hare" was widely used in Lewis Carroll's time, the earliest written record is in John Heywood's 1546 collection of proverbs. Heywood may have mis-spelled his name, but he collected a great many pithy sayings: "While the sun shineth, make hay", "lve me love my dog", "This hitteth the nail on the head", and "All is well that ends well" among them.

Animal of the Week February 26, 2007 -- like a little baby human with bloodlust and hair

Well Chaps,

The whole colossal squid thing is so 2005 (http://animal-of-the-week.blogspot.com/2005_09_01_archive.html), so with the discovery of stone age tools and more recently a manufactured spear, I have no choice but to make this week's animal of the week Pan troglodytes (chimpanzee).

The discovery of 4000 year old anvils and hammer stones and traces of smashed panda nuts in Ivory Coast reported in Proceedings on the National Academy of Science a couple of weeks back, was a fantastic finding—it appears that when most humans were getting to grips with stone tools and agriculture, the chimps were developing ballet... they had a nutcracking suite.

No? Alright.

This week, it emerges that US scientists in Senegal have witnessed a chimpanzee making and using a spear to kill a bushbaby. Well known for fishing for termites with thin sticks and hunting monkeys in troops. This is the first time that a non-human animal has been observed making and using a tool to hunt for meat. The female took a thin branch, appeared to work one end to a point with her teeth, then jabbed it into a hole in a tree. At first the researchers though she was trying to fish out a beetle grub, but after a few stabs, she broke through to the hollow in the tree and pulled out the well and truly stabbed body of a bush baby. Although successful hunting was observed only once, researchers say several females were seen attempting to hunt in this way.

Now, most hunting by chimpanzees is done by the males, but most tool use by females. Anthropologists reckon that this discovery suggests that females might have also been integral to the development of tool use for hunting in human evolution too. Interestingly, these particular chimps live in savannah mosaic habitat, similar to that in which the human lineage is first presumed to have broken away from that of chimpanzees.

Perhaps, the ancestors of chimps and humans also used tools and that both species have inherited this same behaviour. Personally, I reckon the behaviour has evolved indepedently, if the chimps had really been using these sorts of tools for the past 5-8 million years, why haven't they got to a more advanced stage with it? 2.5 million years ago species of Homo were crafting bone tools and stone axes: have the Pans really not progressed beyond sticks and flat stones in all that time?

Mind you, give them time, and I can see this going the way of humans: it just seems natural that the females should send their tools out hunting. Girls, you know what I'm talking about (obviously that needs to be delivered by a large American lady on a housewife-oriented daytime show).

Sorry, I'm way off the mark this week.