Animal of the Week -- May 28, 2007

Sorry, sorry, sorry.

Animal of the Week? Animal of the Fortnight more like!

Still, just time for one more marsupial for May. And this week's is a weird but beautiful creature. It's Notoryctes typhlops (southern marsupial mole)!

Like moles of the northern hemisphere and the golden moles of Africa, marsupial moles are extremely highly adapted to a burrowing (or fossorial, to use the technical language) lifestyle. Like the others they have big shovel-like claws on their front legs, hard nose, fused neck vertebrae, and they are blind because where their eyes should be, there is merely skin and lovely cream coloured velvety fur.

Living in desert environments, these moles swim through the sand searching for worms, witchetty grubs (http://animal-of-the-week.blogspot.com/2006/11/animal-of-week-november-13-2006.html), other larvae, and the occasional lizard. Another cunning adaptation to the fossorial lifestyle, this marsupial's pouch (or marsupium, to use the technical language) points backwards.

Once, the two species of marsupial mole were thought to be monotremes related to the platypus and echidna, not marsupials at all. Until recently their incredibly specialised form confounded taxonomists who were unable to work out how they were related to other marsupials. But actually these moles are most closely related to carnivorous marsupials such as numbats, Tasmanian devils, quolls, and the recently extinct Tasmanian tiger.

So anyway, this is the marsupial mole, it is animal of the week, and I am off now.

Byeee!

Animal of the Week -- May 14, 2007

And let it be known that May 2007 was the month of marsupials. For this week's animal of the week is Monodelphis domesticus (grey short-tailed opossum, or grijze of gewone kortstaartopossum for my Dutch readers).

Hopping continents from last week's Australasian representative of the marsupials, this wee mouse-like marsupial hails from the forests of Brazil and Bolivia. Arboreal in habit and unremarkable in many respects, the grey short-tailed opossum is most notable for being the first marsupial to have its genome sequenced (published in the journal Nature [I have obligations]). A popular laboratory animal, scientists hope that knowledge of its genetic make up will provide insights into how its babies, which are born at about the same developmental stage as a 40 day old human foetus, manage to survive simply clinging to the teat of their mother without an immune system and how the young repair their spinal cords if they are severed. Comparison between this genome and that of other sequenced mammals, such as human beings, chimpanzees, and mice will reveal some of the major differences evolved since the divergence of marsupials and the rest of us some 180 million years ago.

Given that the word marsupial is derived from marsupium, it seems a damn cheek that these animals don't have a pouch -- the young simply hang from their mothers' teats. The word opossum comes from the native-American Algonquian word "wapathemwa" for the Virginia opossum. The word the comes from the word.

And for the DNA freaks amongst you here's a joke:

ACGAAATTTATGGGCACACGGGGCGCAATTGGTTTGGCCCAAACCACACATTTGT
TTCTCCCGAGTCCCGAGATCACATTCGAGCCTCTCACTACTAGCAGACGACGACT
ACATATACT

ORF ORF!

Animal of the Week -- May 7, 2007

Although Andrew Motion was quaking in his boots when he first saw last week's effort, he was quickly relieved when he spotted my egregious error in suggesting that the people conned in the poodle scam had been given back their mediaeval instrument rather than their "loot". I would like to say that I spotted the error myself, but if I told you that I would be a lyre.

Crashing on, this week's animal of the week is Dendrolagus mbaiso (dingiso, bondegezou). This cute little bundle of loveliness is a tree kangaroo from the Western New Guinea region of Indonesia. I always found it bizarre that a kangaroo should climb a tree, but dingisos are doubly weird as their ancestors came back down from the trees and they are largely terrestrial, spending little if any time in trees. Such evolutionary wrong-headedness would typically make the kangaroos an easy target for human hunters. Fortunately, the local Moni people regard dingisos as ancestors and do not hunt them, even though the kangaroos can be coaxed from a tree with a handful of succulent leaves and a noose easily slipped around their neck. When they encounter human beings, dingisos wave their arms in the air and whistle like pie-eyed new-rave devotees in New Cross, and the Moni view this as a greeting from their ancestors. Sounds like a partnership made in heaven for the Moni and the dingisos.

Evolving in a land without other mammals, tree kangaroos fill the niches generally taken by monkeys. And their commitment to this must be viewed with some respect. Fitting huge hind legs developed for bounding across open plains up a tree is not easy. Dingisos have, however, readapted to life on the ground, whereas other tree kangaroos have shorter hind legs and very long tails, the reverse is true of these lovely black and white fellows. Their striking pied fur is very dense, an adaptation to their life at high altitudes where the temperature can drop to below zero most nights. I salute these weird critters: the black and white, new rave, ground-tree kangaroos.

Animal of the Week -- April 30, 2007

AOTW Ovis aries (domestic sheep)



The Japanese Poodle Fleece a poem by Peter Hayward age 28 and 3/4

In Japan, we were told, by the tabloid fold
that sheep are poorly known
And that a poodle would vend for a great many yen
If properly clipped and mown

Spotting a scam, an unscrupulous man,
reported the Sun and Express,
trimmed a woolly white sheep to have pom pom feet
for a Japanese star actress

For twelve-hundred pound she bought her hound
so she thought, so rare and so fine
But of the Pedigree Chum her dog would eat none
Since its tastes were distinctly ovine

The rogue we are told, went on and sold
Pets to geishas and makers of noodles
For each one in turn a tidy profit he'd earn
As he was passing off sheep as pet poodles

The fabled actress found her "dog" in distress
As long toenails impinged on its moves
When she went to the vet, a surprise he did get
"These are not claws, they are hooves!"

The papers report that the rogue was then caught
And put in a cell with a lock
Those who were duped, got back their loot
And the sheep were returned to the flock

But the next day it is stated the tale was fabricated
Not a word of the story was true
Never there was a sheep dressed as a dog
Not a ram, not a lamb, not a ewe

Even though it was fake, the story was great
Spreading grins from ear to ear
And if you're a dog or a sheep, expensive or cheap
They'll eat you both up in Korea

*I would like to say sorry for any racial stereotyping/myth propagation -- I hope no-one takes offence and sincerely apologise if you do*

Robins not nightingales -- non AOTW

Picture this, London 1998, in my second year as a Zoology student at UCL I lived in the delightful NW area of Kilburn, it's delightful now with many nice bars and eateries and the marvellous music venue The Luminaire, it wasn't so nice then, and even worse to the north, appropriately up Shoot Up Hill, was the borough of Cricklewood -- or gangster and skag central as it was then.
One night, on may way back from, erm, some late night study, I fell asleep on the night bus only to wake up in the aforementioned Cricklewood. Now, it was late, buses were infrequent, and I was, erm, confused. My failsafe way to navigate home was by the sound of birdsong because there was a robin that sang all night outside my window.
The clear light of day made me realise that this was a foolish thing to have done as there must have been thirty or more robins along my walk home, nonetheless, the clear light of day found me curled up in my bed. For I had successfully navigated home by the sound of the robin's song.
Thank god for noise pollution during the day, for this is the latest explanation for why robins sing throughout the night. Many people think it is nightingales, but you only get them in Berkley Sq, they are too posh for elsewhere in London.

Sumatran Rhino on Borneo -- not AOTW

Well, you know what, I am going to start doing this more often. Seems silly that that crazy rhino story is announced and I can't comment until Monday. So, it may still be AOTW next week, it may not be, but here is a link to that video of the Borneo subspecies of Sumatran rhino (Dicerorhinus sumatrensis harrissoni -- eastern Sumatran rhino).
As editors at The Lancet will know, Sumatran rhinos are the hairiest of all the rhinos. Even these erudite and learned folks may not know that these rhinos are the closest living relatives of the woolly rhinoceroses that inhabited Eurasia during last ice age.

Animal of the Week -- April 23, 2007

Happy Saint George's Day Ani-freaks!

What did you have for breakfast this morning? Perhaps you had some muesli with dried raspberries and strawberries in it, perhaps you had some wholewheat cereal with soy milk, perhaps you had some toast and honey, you might also have popped some bee pollen to take on it's putative benefits, or have you moisturised with a royal jelly face cream, or maybe you even did a little polishing with beeswax (don't you ever say that I don't know my audience). Well, if so, you should spare a thought for this week's animal of the week and cherish the experience, because, it is a tough time to bee Apis mellifera (western honey bee).

Having been ravaged by the vampire mite Varroa for the past 20 years or so, the primary pollinators of apples, soft fruit, beans, and many wild flowers are now facing new threats. Across the USA and Europe, beekeepers have anticipated the waking of their hives, but up to 60% have remained silent, and under investigation have turned out to be ghost hives, food in the cells, young bees abandoned, but no sign of the adults. No one knows the cause of this Colony Collapse Disorder (CCD), although pesticides, GM crops, global warming, and even electromagnetic radiation have been proposed as possible causes. To test the last of these theories a US scientist placed base units for cordless phones in beehives and found that the radiation from them stopped bees navigating home. He also found answering the phone a painful experience and that there was a terrible buzz on the line. Although he never forgot where he left the handset.

And as CCD sweeps the USA and Europe, Europe's bees face another new threat, Vespa velutina, the Asian hornet. At 4 and a half centimetres long and with a wingspan of 6 centimetres, this hornet has swept across France since being introduced a couple of years ago. A group of 30 hornets can kill 30 000 bees in a few hours, biting them in half and stinging them with their powerful toxins. They leave a pile of bisected bees at the hive entrance and plunder the honey bee larvae to take back to their own for dinner.

Our western bees could learn a thing or two from their Asian cousins, Apis cerana. Threatened by a hornet, a group of bees cluster around the giant hornets creating a ball and start to vibrate. The vibrations which they normally use to regulate temperature in the brood chambers can raise the temperature of the bee ball to 46 degrees centigrade and cook the hornet at the centre. Neat, eh?

So, it's not good news for western honey bees right now. Stockpile honey and don't expect bumper crops of many of your favourite summer fruits.

See this video for the outcomes of hornet attacks on European bees and Asian bees (Bees 1, Hornets 1):

It bee mighty entertaining.